View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9873_low_16 (Length: 487)
Name: NF9873_low_16
Description: NF9873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9873_low_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 455; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 455; E-Value: 0
Query Start/End: Original strand, 19 - 481
Target Start/End: Complemental strand, 42603386 - 42602924
Alignment:
| Q |
19 |
gttcagtctctaatggttcatcggagagtcagagtttgagcttgaggttgaatgagaatgcatcagaacatgaagagggtaatggttcagggaatcctta |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42603386 |
gttcagtctctaatggttcatcggagagtcagagtttgagcttgaggttgaatgagaatgcatcagaacatgaagagggtaatggttcagggaatcctta |
42603287 |
T |
|
| Q |
119 |
tcagcatgaaggtactgaagtcgagacaggagaagaggacgaagaagaggagcatcgtggttttgagcttttgagcttgcttactggttgtgtcgatgcc |
218 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42603286 |
tcagcatgaaggtactgaagtggagacaggagaagaggacgaagaagaggagcatcgtggttttgagcttttgagcttgcttactggttgtgtcgatgcc |
42603187 |
T |
|
| Q |
219 |
attgggtcaaggaatgtggctgcagtcaaccatttcattgcaaaattgggtgatcttgcatctccaagaggaacttcgataagccgaatttgtgcttatt |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42603186 |
attgggtcaaggaatgtggctgcagtcaaccatttcattgcaaaattgggtgatcttgcatctccaagaggaacttcgataagccgaatttgtgcttatt |
42603087 |
T |
|
| Q |
319 |
ttacagaagccttagccatcagagtcactaggctttggcctcatgtttttcaaatcagtgccacttctcgcgattttgacagggtggtggatgatgatga |
418 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42603086 |
ttacagaagccttagccatcagagtcactaggctttggcctcatgtttttcaaatcagtgccacttctcgcgattttgacagggtggtggatgatgatga |
42602987 |
T |
|
| Q |
419 |
aactgtcactgcattgaggcttctaaaccaggttaccccaattcccaagtttcttcatctcac |
481 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42602986 |
aactgtcactgcattgaggcttctaaaccaggttaccccaattcccaagtttcttcatttcac |
42602924 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 65; Significance: 2e-28; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 389 - 481
Target Start/End: Complemental strand, 37498502 - 37498410
Alignment:
| Q |
389 |
cgattttgacagggtggtggatgatgatgaaactgtcactgcattgaggcttctaaaccaggttaccccaattcccaagtttcttcatctcac |
481 |
Q |
| |
|
||||||||||| ||| ||||| |||||||||| ||||||||||||||||||| |||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
37498502 |
cgattttgacaaggttgtggacgatgatgaaattgtcactgcattgaggcttttaaaccaggttaccccaatttccaagtttcttcatttcac |
37498410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University