View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9873_low_54 (Length: 287)
Name: NF9873_low_54
Description: NF9873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9873_low_54 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 104; Significance: 7e-52; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 104; E-Value: 7e-52
Query Start/End: Original strand, 172 - 275
Target Start/End: Original strand, 29404764 - 29404867
Alignment:
| Q |
172 |
ctggcagttattggaagttttagtactatgaaactatgtaaaatatgttatgtcagttcagtttttgtatcagaccggttacatgaatcaaagcagttat |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29404764 |
ctggcagttattggaagttttagtactatgaaactatgtaaaatatgttatgtcagttcagtttttgtatcagaccggttacatgaatcaaagcagttat |
29404863 |
T |
|
| Q |
272 |
ttct |
275 |
Q |
| |
|
|||| |
|
|
| T |
29404864 |
ttct |
29404867 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 78
Target Start/End: Original strand, 29404612 - 29404670
Alignment:
| Q |
20 |
actatagcacttgcacttcacctagacgagtaaagagacatctctcaaaagatggatca |
78 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29404612 |
actatagcacttgcatttcacctagacgagtaaagagacatctctcaaaagatggatca |
29404670 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 177 - 275
Target Start/End: Complemental strand, 8978320 - 8978221
Alignment:
| Q |
177 |
agttattggaagttttagtactatgaaactatgtaaaatatgttatgtcagttcagtttttgt-atcagaccggttacatgaatcaaagcagttatttct |
275 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||| | ||| | | |||||||||| | |||||||| |||||||| | ||||||||||||||| |
|
|
| T |
8978320 |
agttattggaagttttagtattgtgaaactatgtaaaaaaagttgtttatgttcagttttaataatcagaccaattacatgattgaaagcagttatttct |
8978221 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 19 - 78
Target Start/End: Complemental strand, 26960432 - 26960373
Alignment:
| Q |
19 |
tactatagcacttgcacttcacctagacgagtaaagagacatctctcaaaagatggatca |
78 |
Q |
| |
|
|||||||||||||||| |||||||||| ||||| |||| |||||||||||||||||||| |
|
|
| T |
26960432 |
tactatagcacttgcatttcacctagataagtaaggagatatctctcaaaagatggatca |
26960373 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 19 - 78
Target Start/End: Original strand, 26943505 - 26943564
Alignment:
| Q |
19 |
tactatagcacttgcacttcacctagacgagtaaagagacatctctcaaaagatggatca |
78 |
Q |
| |
|
|||||||||||||| | |||||||||| ||||| |||| |||||||||||||||||||| |
|
|
| T |
26943505 |
tactatagcacttgaatttcacctagataagtaaggagatatctctcaaaagatggatca |
26943564 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 177 - 275
Target Start/End: Complemental strand, 47662082 - 47661983
Alignment:
| Q |
177 |
agttattggaagttttagtactatgaaactatgtaaaatatgttatgtcagttcagttt-ttgtatcagaccggttacatgaatcaaagcagttatttct |
275 |
Q |
| |
|
|||||||||||||||||||| | | ||||||||||||| | ||| ||| ||||||||| | ||||||||| || ||||||| ||| ||||||||||| |
|
|
| T |
47662082 |
agttattggaagttttagtattgttaaactatgtaaaagaggttgtgtgtgttcagtttgtattatcagaccaatttcatgaatgaaatcagttatttct |
47661983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 20 - 78
Target Start/End: Original strand, 36658825 - 36658880
Alignment:
| Q |
20 |
actatagcacttgcacttcacctagacgagtaaagagacatctctcaaaagatggatca |
78 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||| || ||||||||||||||||| |
|
|
| T |
36658825 |
actatagcacttgcatttcacct---cgagtaaagaggtatatctcaaaagatggatca |
36658880 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University