View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9873_low_55 (Length: 286)
Name: NF9873_low_55
Description: NF9873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9873_low_55 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 13 - 274
Target Start/End: Complemental strand, 19857198 - 19856937
Alignment:
| Q |
13 |
catagggcaatggggtttgctccatatggagagtactggaggaatttgaggaggatttcttcaacccatttgttttgtcctaggaggattaatgggtttg |
112 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19857198 |
catagggcaatggggtttgctccgtatggagagtactggaggaatttgaggaggatttcttcaacccatttgttttgtcctaggaggattaatgggtttg |
19857099 |
T |
 |
| Q |
113 |
aaggttttaggagtgaggttggtttgaaaatggttgagaggattaagtttttgatgggtgatatgggtagtgttgaggtgaaaaaagttcttcattttgg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19857098 |
aaggttttaggagtgaggttggtttgaaaatggtggagaggattaagtttttgatgggtgatatgggtagtgttgaggtgaaaaaagttcttcattttgg |
19856999 |
T |
 |
| Q |
213 |
ttcacttaataatgtgatgatgactgtgtttggaaaatgttatgatttctttgatggtgatg |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19856998 |
ttcacttaataatgtgatgatgactgtgtttggaaaatgttatgatttctttgatggtgatg |
19856937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University