View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9873_low_57 (Length: 281)
Name: NF9873_low_57
Description: NF9873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9873_low_57 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 2 - 265
Target Start/End: Complemental strand, 31769198 - 31768940
Alignment:
| Q |
2 |
gcataggacctttccaaacttattaataatatctttcaaagcttcttctnnnnnnnnnnnttcttttaaagctttctaaacatattaataatatctttta |
101 |
Q |
| |
|
||||||| |||||| |||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31769198 |
gcatagggcctttctaaacttattaataatatctttcaaagcttcttctaaaaaaaaaaat-cttttaaagctttctaaacatattaataatatctttta |
31769100 |
T |
 |
| Q |
102 |
aagcttcttctgaaaataaaataaaattaagtgactcttatgcaagtgtttcatttgatctaagacaaacttatttttgaaaatagtttgaaattcttat |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31769099 |
aagcttcttctgaaaataaaataaaattaagtgactcttatgcaagtgtttcatttgatctaagacaaacttatttttgaaaatagtttgaaattcttat |
31769000 |
T |
 |
| Q |
202 |
attatcggtgttgctatttgtaaggagaagctcgtgatattacttacttgttatcacaagtgag |
265 |
Q |
| |
|
|||||||||||| ||||||||||| |||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
31768999 |
attatcggtgtttctatttgtaagtagaaactcgtgatatt----acttgttatcacaagtgag |
31768940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University