View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9873_low_66 (Length: 263)
Name: NF9873_low_66
Description: NF9873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9873_low_66 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 10 - 248
Target Start/End: Complemental strand, 35644493 - 35644257
Alignment:
| Q |
10 |
gtgttaacctattttattttctttgcatacaccaaatcctatgcaaactcccgatttattgtttttaattaagcttaatataattggtgagtcgaacaac |
109 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
35644493 |
gtgttaacctattttactttctttgcatataccaaatcctatgcaaactcccgatttattgtttttaattaagcttaatataattgtcgagtcgaacaac |
35644394 |
T |
|
| Q |
110 |
aatccctgtaaaaacaatatctacttactacttgattgcttgtgtgattcggtatacttattttatttgtcataaaccctcaactaaggttccgacaagg |
209 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
35644393 |
aatctctgtaaaaacaatatctacttactacttgattacttgtgtgattcggtatacttattttatttgtcataaacccacaactaaggtttcgacaagg |
35644294 |
T |
|
| Q |
210 |
caaagagcagatctgatcatgatagccaagtggaagaag |
248 |
Q |
| |
|
| | ||||||| |||||||||||||||| ||||||||| |
|
|
| T |
35644293 |
cga--agcagatttgatcatgatagccaaatggaagaag |
35644257 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University