View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9873_low_83 (Length: 242)
Name: NF9873_low_83
Description: NF9873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9873_low_83 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 45 - 230
Target Start/End: Complemental strand, 27933830 - 27933633
Alignment:
| Q |
45 |
aggattaaatttgaatttttgtcactttacgtgatatcaactta----tgttcaagtattctaatattttataaaattat--------atcatacttcaa |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||| | |||||||||| |
|
|
| T |
27933830 |
aggattaaatttgaatttttgtcactttacttgatatcaacttaattatgttcaagtattctaatattttataaaattattaaaatatagcatacttcaa |
27933731 |
T |
|
| Q |
133 |
tttaacattaagagaccaacttgaaattatattgattattagtatcataaagaaacaacaacccattacaggaatcaagaatacaataatagtgtctc |
230 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27933730 |
tttaacattaaaagaccaacttgaaattatattgattattagtatcataaagaaacaacaacccattacaggaatcaagaatacaataatagtgtctc |
27933633 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University