View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9874_high_12 (Length: 242)
Name: NF9874_high_12
Description: NF9874
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9874_high_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 18 - 229
Target Start/End: Complemental strand, 836543 - 836342
Alignment:
| Q |
18 |
ctaaaaatatagtgcggtattttctaaagtagtaaagatcctgtgcaatattgcacgattgcgaaaaaacaaagtgacataaaatagtaaatatcacgta |
117 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
836543 |
ctaaaaatatagtgcggtatttactaaagtagtaaagatcatgtgcaatattgcacgattgcgaaaaaacaaagtgacataaaatagtaaatatcacgta |
836444 |
T |
 |
| Q |
118 |
caattctgttaaacttaatgtctttctgtgcgttcgaattcgctgtccttcgattttctaaagttacttcaattttctgaagttaccataaaaagtctga |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
836443 |
caattctgttaaacttaatgtctttctgtgcgttcgaattcgctgtccttcaattttctaaagtta----------ctgaagttaccataaaaagtctga |
836354 |
T |
 |
| Q |
218 |
gggtactcgtct |
229 |
Q |
| |
|
|||||||||||| |
|
|
| T |
836353 |
gggtactcgtct |
836342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University