View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9874_low_12 (Length: 249)
Name: NF9874_low_12
Description: NF9874
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9874_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 50550154 - 50550397
Alignment:
| Q |
1 |
catcattggtttaataaaataaaatgaattagtggtgattaaactataccaacatctagattgagtagtgttgtagtattaatcgatggggcaattggat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50550154 |
catcattggtttaataaaataaaatgaattagtggtgattaaactataccaacatctagattgagtagtgttgtagtattaatcgatggggcaattggat |
50550253 |
T |
 |
| Q |
101 |
atcagttaagtgggtgcgtaatttcattataaatgatttttacgctgacgtcgagttgaattgaagctcagtactatcttgccatttcatattgtgatta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
50550254 |
atcagttaagtgggtgcgtaatttcattataaattatttttacgctgacgtcgagttgaattgaagctcactactatcttgccatttcatattgtgatta |
50550353 |
T |
 |
| Q |
201 |
ttattggctgcttgtacaagatattatcaaagatcctttgcttc |
244 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
50550354 |
ttattggctgcttgtaaaagatattatcaaagatcctttgcttc |
50550397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University