View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9874_low_14 (Length: 245)
Name: NF9874_low_14
Description: NF9874
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9874_low_14 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 7 - 245
Target Start/End: Complemental strand, 44041674 - 44041434
Alignment:
| Q |
7 |
tgagatggacatcacagtccccacaattttgatctggcttattgagcttccagcatccaacttctccatcctacaatggtttttgaaatagtaaaataat |
106 |
Q |
| |
|
|||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
44041674 |
tgagatagacaccacagtccccacaattttgatctggcttattgagcttccagcatccaacttctccatcctacaacggtttttgaaatagtaaaataat |
44041575 |
T |
 |
| Q |
107 |
ccaactgttatgcataattataagtttgcataagaacctctaaacatggttgtttatttatattttagtactatcaacacattatctaacac--attttc |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
44041574 |
ccaactgttatgcataattataagtttgcataagaacctctaaacatggttgtttatttatattttagtactatcaacacattatctaacacatattttc |
44041475 |
T |
 |
| Q |
205 |
caacacacctatttacctgaagatgactgctagaacaaaag |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44041474 |
caacacacctatttacctgaagatgactgctagaacaaaag |
44041434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University