View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9874_low_2 (Length: 558)
Name: NF9874_low_2
Description: NF9874
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9874_low_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 64; Significance: 1e-27; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 135 - 249
Target Start/End: Complemental strand, 29237107 - 29236992
Alignment:
| Q |
135 |
ctatttacacgtcattgctagaaatctgaaatggtttatgctgtatatttagcttgttaatgaccataaattgtatctttagctcaatttg-tatgacag |
233 |
Q |
| |
|
|||||| |||||| || |||||||||||||||||||||||| ||||||||||||||| |||||||| ||||||||||||| ||||||||| ||| |||| |
|
|
| T |
29237107 |
ctatttccacgtcgttactagaaatctgaaatggtttatgcagtatatttagcttgtagatgaccatgaattgtatctttatctcaatttgttattacag |
29237008 |
T |
 |
| Q |
234 |
atagctacaataattt |
249 |
Q |
| |
|
||| ||| |||||||| |
|
|
| T |
29237007 |
ataactagaataattt |
29236992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 472 - 531
Target Start/End: Complemental strand, 29205599 - 29205540
Alignment:
| Q |
472 |
tagggatatgatgttggaaatataccattttatctcacccttcgacttagctaaagcaat |
531 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29205599 |
tagggatacgatgttggaaatagaccattttatctcacccttcgacttagctaaagcaat |
29205540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 41; Significance: 0.00000000000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 18 - 81
Target Start/End: Original strand, 28635896 - 28635962
Alignment:
| Q |
18 |
taatttcttatgaattctgaatttgaaga---tggattaatttccaaaaatgggagaaggagatgaa |
81 |
Q |
| |
|
|||||||||||||| | |||||||||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
28635896 |
taatttcttatgaactatgaatttgaagaagatgaattaatttccaaaaatgggagaaggagatgaa |
28635962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University