View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9875_high_11 (Length: 269)
Name: NF9875_high_11
Description: NF9875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9875_high_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 19 - 252
Target Start/End: Original strand, 33103241 - 33103474
Alignment:
| Q |
19 |
attgtgaaatgtgaaattgattttgatttgttgattatatgttaaaaatgaaggtatgccagaaacagagcttggtggggaagagttgaagtttccagta |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33103241 |
attgtgaaatgtgaaattgattttgatttgttgattatatgttaaaaatgaaggtatgcaagaaacagagcttggtggggaagagttgaagtttccagta |
33103340 |
T |
|
| Q |
119 |
aaagaagaagaattgctggtagaagatgaggtagggaaagtggaaccagctgccctgaacaagctaggaggatccagctcaacggcggagctacacccaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33103341 |
aaagaagaagaattgctggtagaagaagaggtagggaaagtggaaccagctgccctgaacaagctaggaggatccagctcaacggcggagctacacccaa |
33103440 |
T |
|
| Q |
219 |
cagccaccgtgaaacatatgcctccggcaagtgt |
252 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |
|
|
| T |
33103441 |
cagccaccgtgaaacacatgcctccggcaagtgt |
33103474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University