View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9875_high_17 (Length: 246)
Name: NF9875_high_17
Description: NF9875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9875_high_17 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 18 - 229
Target Start/End: Complemental strand, 14909719 - 14909508
Alignment:
| Q |
18 |
caaaagacagcatacagaagatagatcatatttaggatatatcttgaaggaaatctggatgaccagtgctctgtttgacacctgtacttatcattttact |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14909719 |
caaaagacagcatacagaagatagatcatatttaggatatatcttgaaggaaatctggatgaccagtgctctgtttgacacctgtacttatcattttact |
14909620 |
T |
 |
| Q |
118 |
cctagaataggcaatagagtggcccattgtctggcccaacttgctcatttagaacccaataaaatttggaaggataatgttccctcccaagcttactctt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
14909619 |
cctagaataggcaatagagtggcccattgtctggcccaacttgctcatttagaacccaataaagtttggaaggataatgttccctcccaagcttactctt |
14909520 |
T |
 |
| Q |
218 |
tatacgcctatg |
229 |
Q |
| |
|
|||||||||||| |
|
|
| T |
14909519 |
tatacgcctatg |
14909508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University