View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9875_high_25 (Length: 213)
Name: NF9875_high_25
Description: NF9875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9875_high_25 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 1 - 192
Target Start/End: Original strand, 6587791 - 6587983
Alignment:
| Q |
1 |
cagacacgccgcggtatttattcgtgtaaaaatatttgaaattgaaatgaaacaagcatagag-aaagagcggctctaggcctgagcttaattcatccct |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
6587791 |
cagacacgccgcggtatttattcgtgtaaaaatatttgaaattgaaatgaaacaagcatagagaaaagagcggctctaggcctgagcttaattcatccct |
6587890 |
T |
 |
| Q |
100 |
ttttctatcaaaaatcaataatctctttagtnnnnnnntaaaggttaaattagaccgggagtcttttcggtttgaggtttgtaatagatcggt |
192 |
Q |
| |
|
|||||||| |||||||||||||||||||||| |||||||||||||||| ||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
6587891 |
ttttctataaaaaatcaataatctctttagtaaaaaaataaaggttaaattagatcggaagtctttttagtttgaggtttgtaatagatcggt |
6587983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University