View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9875_high_4 (Length: 424)
Name: NF9875_high_4
Description: NF9875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9875_high_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 213; Significance: 1e-117; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 194 - 410
Target Start/End: Original strand, 1549745 - 1549961
Alignment:
| Q |
194 |
gttcaagttcaagtactagtctaattggagggaaacaaatgcttatattgtgtggatttggttattggttacaagggtttagatgttttccttggcttgc |
293 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1549745 |
gttcaagttcaagtactagtgtaattggagggaaacaaatgcttatattgtgtggatttggttattggttacaagggtttagatgttttccttggcttgc |
1549844 |
T |
|
| Q |
294 |
tcttaattttcatatggctagtaatctcaatttggacccttcaatattgcaacttgtacagtattctgctaatcttcctatggtggctaaaccactctat |
393 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1549845 |
tcttaattttcatatggctagtaatctcaatttggacccttcaatattgcaacttgtacagtattctgctaatcttcctatggtggctaaaccactctat |
1549944 |
T |
|
| Q |
394 |
ggaattctttctgatgt |
410 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
1549945 |
ggaattctttctgatgt |
1549961 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 100; E-Value: 3e-49
Query Start/End: Original strand, 1 - 116
Target Start/End: Original strand, 1549552 - 1549667
Alignment:
| Q |
1 |
catcacaaaagaccaatcataacatgttcacaacatcacaagaattcaagaaacttcgttgagaaacaatctcaacaacccacattcatggttgacacac |
100 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
1549552 |
catcacaaaagaccaaccataacatgttcacaacatcacaagaattcaagaaacttcattgagaaacaatctcaacaacctacattcatggttgacacac |
1549651 |
T |
|
| Q |
101 |
acaaaaattttgttgt |
116 |
Q |
| |
|
| |||||||||||||| |
|
|
| T |
1549652 |
ataaaaattttgttgt |
1549667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University