View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9875_low_20 (Length: 241)
Name: NF9875_low_20
Description: NF9875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9875_low_20 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 18 - 241
Target Start/End: Complemental strand, 42095259 - 42095034
Alignment:
| Q |
18 |
gtgattgtataatggttatatagttaatgcggtggatatttttcgaaggggaaggggcactcataatctcaagttcgactaatgttgtttcaattttact |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42095259 |
gtgattgtataatggttatatagttaatgcggtggatatttttcgaaggggaaggggcactcataatctcaagttcgactaatgttgtttcaattttact |
42095160 |
T |
|
| Q |
118 |
attttcttctcacacaatttatactcagcannnnnnnnnngtttctttaggaactgtaacttctcttatagtta--gtgactaggtttgagttcatatgt |
215 |
Q |
| |
|
|||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
42095159 |
atttccttctcacacaatttatactcagcatattttttttgtttctttaggaactgtaacttctcttatagttagtgtgactaggtttgagttcatatgt |
42095060 |
T |
|
| Q |
216 |
tgaagatgatgatggagagtgaagct |
241 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
42095059 |
tgaagatgatgatggagagtgaagct |
42095034 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University