View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9875_low_22 (Length: 240)
Name: NF9875_low_22
Description: NF9875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9875_low_22 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 18 - 240
Target Start/End: Complemental strand, 6220924 - 6220705
Alignment:
| Q |
18 |
aatcatgtcttcattactagtatacctgactaattcaccattatttcattaggattaggataggattagaatacagtataggctggttcaccttaacttt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6220924 |
aatcatgtcttcattactagtatacctgactaatttaccattatatcattaggattaggataggattagaatacagtataggctggttcaccttaacttt |
6220825 |
T |
 |
| Q |
118 |
aactagagatactccaattttgtttaaaaagatcttgaccaattggaatggttatgcattcataaattttgattttgctcattttactcaatatatgtga |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6220824 |
aactagagatactccaattttgtttaaaaagatcttgaccaattggaatagttatgcattcataaattttgattttgctcattttactcaatatatg--- |
6220728 |
T |
 |
| Q |
218 |
tgtgagacttcattccaacaatt |
240 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
6220727 |
tgtgagacttcattccaacaatt |
6220705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University