View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9875_low_26 (Length: 223)
Name: NF9875_low_26
Description: NF9875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9875_low_26 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 20 - 209
Target Start/End: Complemental strand, 46453053 - 46452863
Alignment:
| Q |
20 |
gctctaaaccagtcgattgggggagcggggcaaataatctccatgatggaaggaggggatcgagagtagcaagacactaacgtactagaattaaatggac |
119 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46453053 |
gctctaaaccagttgattgggggagcggggcaaataatctccatgatggaaggaggggatcgagagtagcaagacactaacgtactagaattaaatggac |
46452954 |
T |
|
| Q |
120 |
ataaagtacaccaaag-ctcaatacaaaactacttatatcatcaccagaccagacctagtcacatgtactagtttatcttgttttgttttg |
209 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
46452953 |
ataaagtacaccaaagcctcaatacaaaactacttatatcatcaccagaccagacctagtcacatctactagtttatcttgttttgttttg |
46452863 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University