View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9875_low_30 (Length: 215)
Name: NF9875_low_30
Description: NF9875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9875_low_30 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 142; Significance: 1e-74; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 24 - 193
Target Start/End: Original strand, 24348979 - 24349148
Alignment:
| Q |
24 |
tgaaatactacttcaattgcaagatataaggtaagtcaaacaaaatcgatgtatttgattaaaaatttcttctagtaaaaactaatcttatagttttgat |
123 |
Q |
| |
|
|||||||||||| |||||||||||||||||| ||||||||||||| |||||||||||||||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
24348979 |
tgaaatactactccaattgcaagatataaggcaagtcaaacaaaaccgatgtatttgattaaaagtttcttctggtaaaaactaatcttatagttttgat |
24349078 |
T |
|
| Q |
124 |
ttaaaagttgacgggtttcttatagagcgaaaatcaattgcataagtataatctccatagatttcatccg |
193 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24349079 |
ttaaaagttaacgggtttcttatagagcgaaagtcaattgcataagtataatctccatagatttcatccg |
24349148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 56 - 91
Target Start/End: Original strand, 32600019 - 32600054
Alignment:
| Q |
56 |
aagtcaaacaaaatcgatgtatttgattaaaaattt |
91 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |
|
|
| T |
32600019 |
aagtcaaacaaaatcgatgtatttgtttaaaaattt |
32600054 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University