View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9875_low_5 (Length: 421)
Name: NF9875_low_5
Description: NF9875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9875_low_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 387; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 387; E-Value: 0
Query Start/End: Original strand, 18 - 408
Target Start/End: Original strand, 47692 - 48082
Alignment:
| Q |
18 |
acatcgacatatagcttgcaggagaaaaagcggatgcagtacgaatttcacatccaagtaattttcttttagctatattttgggcagtaggtcctaaatc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47692 |
acatcgacatatagcttgcaggagaaaaagcggatgcagtacgaatttcacatccaagtaattttcttttagctatattttgggcagtaggtcctaaatc |
47791 |
T |
 |
| Q |
118 |
tttaacaaacaacatcaagctatctttgtagccattatcttgttgactaacctatacaaagagtagacataataataagaaaaacacaatataattaatc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47792 |
tttaacaaacaacatcaagctatctttgtagccattatcttgttgactaacctatacaaagagtagacataataataagaaaaacacaatataattaatc |
47891 |
T |
 |
| Q |
218 |
tatgcgaaccataatatatgcattttgcaaaattgcattgacgaaaaagacactgtgagcaaaaacaactcacatgctcaagtagttttaatctatcatc |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47892 |
tatgcgaaccataatatatgcattttgcaaaattgcattgacgaaaaagacattgtgagcaaaaacaactcacatgctcaagtagttttaatctatcatc |
47991 |
T |
 |
| Q |
318 |
atatattgttgaaactattggctcgtcccggtaaaaacgtcgataagtacaatgcctatcaactgcaacagatgtacatatgtgaatgtct |
408 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47992 |
atatattgttgaaactattggctcgtcccggtaaaaacgtcgataagtacaatgcctatcaactgcaacagatgtacatatgtgaatgtct |
48082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University