View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9875_low_9 (Length: 345)
Name: NF9875_low_9
Description: NF9875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9875_low_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 181; Significance: 9e-98; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 181; E-Value: 9e-98
Query Start/End: Original strand, 159 - 343
Target Start/End: Original strand, 25963645 - 25963829
Alignment:
| Q |
159 |
ggtgaaagttttgaggaatgtgcagcgagagaagtgaaagaagaaacagggttagatttgggtgaaaataaaatagagtttttaactgttacaaataatg |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25963645 |
ggtgaaagttttgaggaatgtgcagcgagagaagtgaaagaagaaacagggttagatttgggtgaaaataaaatagagtttttaactgttacaaataatg |
25963744 |
T |
 |
| Q |
259 |
tgtttttggaacagccaaagaaatctcattatgttactatcttcatgagagtggtgttggatgcacaagaggagcatgtgattca |
343 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25963745 |
tgtttttggaacagccaaagaaatctcattatgttactgtcttcatgagagtggtgttggatgcacaagaggagcatgtgattca |
25963829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 116; E-Value: 6e-59
Query Start/End: Original strand, 14 - 157
Target Start/End: Original strand, 25963417 - 25963560
Alignment:
| Q |
14 |
agaaaagcaaatggtgtcgccgccaccagaacctagagttgctgtagtcgtatttctcttgaaaggcagatcgtttcttctcggccgccgttgcgcttcc |
113 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||| |||||||| ||||||||||||||| | |||||| |
|
|
| T |
25963417 |
agaaaagcaaatggtgtcgccgccaccggaacctagagttgctgttgtcgtatttctcttgaaaggtagatcgttccttctcggccgccgtcgtgcttcc |
25963516 |
T |
 |
| Q |
114 |
gtcggagacgcaaccttcgctcttcccggcggccacctcgaatt |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
25963517 |
gtcggagacgcaaccttcgctcttcccggcggccaccttgaatt |
25963560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University