View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9876_high_12 (Length: 254)
Name: NF9876_high_12
Description: NF9876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9876_high_12 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 220; Significance: 1e-121; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 244
Target Start/End: Complemental strand, 31188711 - 31188469
Alignment:
| Q |
1 |
tcttttggtgctttgcattggcagtttttgtgatgtttttgtttctgtttcggtgctgccttgcatattctttttgtgcttcatgtttctgtgttcctag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31188711 |
tcttttggtgctttgcattggcagtttttgtgatgtttttgtttctgtttcggtgctgccttgcatattctttttgtgcttcatgtttctgtgttcctag |
31188612 |
T |
|
| Q |
101 |
tatcttttgctatgaatttgtttttagataggatggtttatgatggtttcttcttgctgcgttggcaactttgattgacgtagggaggatttttcttgtg |
200 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||| || ||||||||| ||||||||||| |
|
|
| T |
31188611 |
tatcttttgctatgaatttgattttagata-gatggtttatgatggtttcttcttgctgcgttggcaactttgatcgatgtagggaggttttttcttgtg |
31188513 |
T |
|
| Q |
201 |
ggtaggtggatgtggaactttagtgtgggtgatgttagtctctg |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31188512 |
ggtaggtggatgtggaactttagtgtgggtgatgttagtctctg |
31188469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 103 - 244
Target Start/End: Complemental strand, 31200450 - 31200309
Alignment:
| Q |
103 |
tcttttgctatgaatttgtttttagataggatggtttatgatggtttcttcttgctgcgttggcaactttgattgacgtagggaggatttttcttgtggg |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
31200450 |
tcttttgctatgaatttgtttttagataggatggtttatgatggtttcttcttgctgcgttggcaactttgattgatgtagggaggttttttcttgtggg |
31200351 |
T |
|
| Q |
203 |
taggtggatgtggaactttagtgtgggtgatgttagtctctg |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
31200350 |
taggtggatgtggaactttagtgtgggtgatgttggtctctg |
31200309 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 1 - 74
Target Start/End: Complemental strand, 31200518 - 31200445
Alignment:
| Q |
1 |
tcttttggtgctttgcattggcagtttttgtgatgtttttgtttctgtttcggtgctgccttgcatattctttt |
74 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31200518 |
tcttttggtgctttgcattggcagtttttgtgatgtttttgtttctgtttcggtgctgccttgcatattctttt |
31200445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University