View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9876_low_14 (Length: 259)
Name: NF9876_low_14
Description: NF9876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9876_low_14 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 219; Significance: 1e-120; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 304157 - 304406
Alignment:
| Q |
1 |
ccacttctcctcatgatcacatattgcttagctttaacaacacattcccaactccaacccaacaagattgtccctttttatcatcgtcgacatcttcatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
304157 |
ccacttctcctcatgatcacatattgcttagctttaacaacacattcccaactccaacccaacaagattgtccctttttatcatcgtcgacatcatcatc |
304256 |
T |
|
| Q |
101 |
atcttttaattcctcacattcag------tggatgaatacctgctctctccgcaaccaatattagataactctatttctacaaggcatgttcttagtact |
194 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
304257 |
atcttttaattcctcacattcagtctcagtggatgaatacctgctctctcctcaaccaatattagataactctatttctacaaggcatgttcttagtact |
304356 |
T |
|
| Q |
195 |
atatcatcatcaactacactagaatctgatgatcacaaggatatgatgat |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
304357 |
atatcatcatcaactacactagaatctgatgatcacaaggatatgatgat |
304406 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 27 - 85
Target Start/End: Complemental strand, 12465785 - 12465727
Alignment:
| Q |
27 |
cttagctttaacaacacattcccaactccaacccaacaagattgtccctttttatcatc |
85 |
Q |
| |
|
||||||||||| || ||||||||||||||||| ||||||| ||||||||||| ||||| |
|
|
| T |
12465785 |
cttagctttaataatacattcccaactccaacaaaacaagaatgtccctttttgtcatc |
12465727 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University