View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9876_low_17 (Length: 254)

Name: NF9876_low_17
Description: NF9876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9876_low_17
NF9876_low_17
[»] chr6 (3 HSPs)
chr6 (1-244)||(31188469-31188711)
chr6 (103-244)||(31200309-31200450)
chr6 (1-74)||(31200445-31200518)


Alignment Details
Target: chr6 (Bit Score: 220; Significance: 1e-121; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 244
Target Start/End: Complemental strand, 31188711 - 31188469
Alignment:
1 tcttttggtgctttgcattggcagtttttgtgatgtttttgtttctgtttcggtgctgccttgcatattctttttgtgcttcatgtttctgtgttcctag 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31188711 tcttttggtgctttgcattggcagtttttgtgatgtttttgtttctgtttcggtgctgccttgcatattctttttgtgcttcatgtttctgtgttcctag 31188612  T
101 tatcttttgctatgaatttgtttttagataggatggtttatgatggtttcttcttgctgcgttggcaactttgattgacgtagggaggatttttcttgtg 200  Q
    |||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||| || ||||||||| |||||||||||    
31188611 tatcttttgctatgaatttgattttagata-gatggtttatgatggtttcttcttgctgcgttggcaactttgatcgatgtagggaggttttttcttgtg 31188513  T
201 ggtaggtggatgtggaactttagtgtgggtgatgttagtctctg 244  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
31188512 ggtaggtggatgtggaactttagtgtgggtgatgttagtctctg 31188469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 103 - 244
Target Start/End: Complemental strand, 31200450 - 31200309
Alignment:
103 tcttttgctatgaatttgtttttagataggatggtttatgatggtttcttcttgctgcgttggcaactttgattgacgtagggaggatttttcttgtggg 202  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||    
31200450 tcttttgctatgaatttgtttttagataggatggtttatgatggtttcttcttgctgcgttggcaactttgattgatgtagggaggttttttcttgtggg 31200351  T
203 taggtggatgtggaactttagtgtgggtgatgttagtctctg 244  Q
    |||||||||||||||||||||||||||||||||| |||||||    
31200350 taggtggatgtggaactttagtgtgggtgatgttggtctctg 31200309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 1 - 74
Target Start/End: Complemental strand, 31200518 - 31200445
Alignment:
1 tcttttggtgctttgcattggcagtttttgtgatgtttttgtttctgtttcggtgctgccttgcatattctttt 74  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31200518 tcttttggtgctttgcattggcagtttttgtgatgtttttgtttctgtttcggtgctgccttgcatattctttt 31200445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University