View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9876_low_27 (Length: 223)
Name: NF9876_low_27
Description: NF9876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9876_low_27 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 52 - 207
Target Start/End: Complemental strand, 7948215 - 7948060
Alignment:
| Q |
52 |
tttgactaggtattttcacatgaggctgaggcgattacagttgagtttatttaatttacatgcatacgttaaatgatgtgctgtcacgttaatttgtact |
151 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||| |
|
|
| T |
7948215 |
tttgactaggtattttcacatgaggccgaggcgattacaattgagtttatttaatttacatgcatacgttaaatgatgtgttgtcacgtcaatttgtact |
7948116 |
T |
 |
| Q |
152 |
ataacaagaaattatgtgtatttattctagtgttattttaatctcttattaatttt |
207 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
7948115 |
ataacaagaaatcatgtgtatttattctagtgttattttaatctcttgttaatttt |
7948060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University