View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9878_high_4 (Length: 219)
Name: NF9878_high_4
Description: NF9878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9878_high_4 |
 |  |
|
| [»] scaffold0734 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 54; Significance: 4e-22; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 11171369 - 11171312
Alignment:
| Q |
1 |
ttgttattgttttttacaagggaccaaaatcccaagattgtattacttacggggttaa |
58 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11171369 |
ttgttattgttttttataagggaccaaaatcccaagattgtattacttacggggttaa |
11171312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 128 - 202
Target Start/End: Complemental strand, 11171240 - 11171166
Alignment:
| Q |
128 |
caaatccacatagaatgattaattcataaagcgatccaannnnnnnncatagtgtacacaactctcttttgtttt |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
11171240 |
caaatccacatagaatgattaattcataaagcgatccaattgtttttcatagtgtacacaactctcttttgtttt |
11171166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0734 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0734
Description:
Target: scaffold0734; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 1956 - 1908
Alignment:
| Q |
1 |
ttgttattgttttttacaagggaccaaaatcccaagattgtattactta |
49 |
Q |
| |
|
|||||||||||||||| | |||||||||||| ||||||||| ||||||| |
|
|
| T |
1956 |
ttgttattgttttttataggggaccaaaatctcaagattgtgttactta |
1908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000007; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 54
Target Start/End: Complemental strand, 2407398 - 2407345
Alignment:
| Q |
1 |
ttgttattgttttttacaagggaccaaaatcccaagattgtattacttacgggg |
54 |
Q |
| |
|
|||||||||||||||| | |||||||||||| ||||||||| |||||| |||| |
|
|
| T |
2407398 |
ttgttattgttttttataggggaccaaaatcgcaagattgtgatacttaggggg |
2407345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 7875756 - 7875716
Alignment:
| Q |
1 |
ttgttattgttttttacaagggaccaaaatcccaagattgt |
41 |
Q |
| |
|
|||||||||||||||| | |||||||||||| ||||||||| |
|
|
| T |
7875756 |
ttgttattgttttttataggggaccaaaatcgcaagattgt |
7875716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 41415712 - 41415672
Alignment:
| Q |
1 |
ttgttattgttttttacaagggaccaaaatcccaagattgt |
41 |
Q |
| |
|
|||||||||||||||| ||||| |||||||| ||||||||| |
|
|
| T |
41415712 |
ttgttattgttttttataaggggccaaaatcgcaagattgt |
41415672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 5003567 - 5003527
Alignment:
| Q |
1 |
ttgttattgttttttacaagggaccaaaatcccaagattgt |
41 |
Q |
| |
|
|||||||||||||||| |||||| ||||||| ||||||||| |
|
|
| T |
5003567 |
ttgttattgttttttataagggatcaaaatcgcaagattgt |
5003527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University