View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9879_high_24 (Length: 395)
Name: NF9879_high_24
Description: NF9879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9879_high_24 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 72; Significance: 1e-32; HSPs: 6)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 299 - 385
Target Start/End: Original strand, 46450020 - 46450106
Alignment:
| Q |
299 |
tatcacttggatgcatgcatagtctgtttgataccatacagggag-actactaaagtgaagaactttgaaaacagcattggatctctg |
385 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
46450020 |
tatcacttggatgcatgcatagtctgtttgataccatacagggagaactactaaagtgaagaac-ttgaaaacagcattggatctctg |
46450106 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 343 - 385
Target Start/End: Original strand, 46433440 - 46433482
Alignment:
| Q |
343 |
gactactaaagtgaagaactttgaaaacagcattggatctctg |
385 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
46433440 |
gactactaaagtgaagaactttgaaaacaacattggatctctg |
46433482 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 264 - 301
Target Start/End: Original strand, 46449944 - 46449981
Alignment:
| Q |
264 |
aacaacattgatgaggggaggttcaaacttcaaactat |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46449944 |
aacaacattgatgaggggaggttcaaacttcaaactat |
46449981 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 174 - 210
Target Start/End: Original strand, 46449905 - 46449941
Alignment:
| Q |
174 |
tataatactagtatgcagctagctagttacaattaat |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46449905 |
tataatactagtatgcagctagctagttacaattaat |
46449941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 343 - 385
Target Start/End: Original strand, 46439062 - 46439104
Alignment:
| Q |
343 |
gactactaaagtgaagaactttgaaaacagcattggatctctg |
385 |
Q |
| |
|
|||||||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
46439062 |
gactactaaactgaagaactttgaaaacaacattggatctctg |
46439104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 207 - 279
Target Start/End: Original strand, 46438426 - 46438499
Alignment:
| Q |
207 |
taatgcagttttatttatgtttgcatcaattttga-agtttcttattatgatggtcaaaacaacattgatgagg |
279 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||| || | | ||||||||| |||||||||| ||||| ||||||| |
|
|
| T |
46438426 |
taatgcagttttatatatgtttgcataaatttggagaatatcttattataatggtcaaaataacatcgatgagg |
46438499 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University