View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9879_high_33 (Length: 359)
Name: NF9879_high_33
Description: NF9879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9879_high_33 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 308; Significance: 1e-173; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 308; E-Value: 1e-173
Query Start/End: Original strand, 19 - 349
Target Start/End: Original strand, 40886561 - 40886894
Alignment:
| Q |
19 |
atgagaacatggtggagaggtcttggagttgggatttgaaatggcggagaaatttctttgaatggaaaaaacatatatttgatgatctttgggcttgatt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40886561 |
atgagaacatggtggagaggtcttggagttgggatttgaaatggcggagaaatttctttgaatggaaaaaacatatatttgatgatctttgggcttgatt |
40886660 |
T |
 |
| Q |
119 |
gggtaatgctaataagtggatttgaatttttgatcaatttagtattttgttgatcaagtactaattatacttctttcataatatgaatgatttttgaacc |
218 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40886661 |
gggtaatgctaataagtggatttgagtttttgatcaatttagtattttgttgatcaagtactaattatacttctttcataatatgaatgatttttgaacc |
40886760 |
T |
 |
| Q |
219 |
ctcttctttatcttcttttttaggaggtattgtttgcagtttggttgatcaggtac---taattatacttctctcgttctacttaataaatttaattttg |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
40886761 |
ctcttctttatcttcttttttaggaggtattgtttgcagtttggttgatcaggtactaataattatacttctctcattctacttaataaatttaattttg |
40886860 |
T |
 |
| Q |
316 |
cagttccaagaaaataccatgcaaccaccctatg |
349 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| |
|
|
| T |
40886861 |
cagttcgaagaaaataccatgcaaccaccctatg |
40886894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 37 - 111
Target Start/End: Original strand, 21418476 - 21418549
Alignment:
| Q |
37 |
ggtcttggagttgggatttgaaatggcggagaaatttctttgaatggaaaaaacatatatttgatgatctttggg |
111 |
Q |
| |
|
|||||||||||||||||||||| |||||||| ||| | ||||||||| ||||| || ||||||| |||||||||| |
|
|
| T |
21418476 |
ggtcttggagttgggatttgaagtggcggaggaatctttttgaatgggaaaaa-atttatttgaagatctttggg |
21418549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University