View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9879_high_37 (Length: 342)
Name: NF9879_high_37
Description: NF9879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9879_high_37 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 291; Significance: 1e-163; HSPs: 6)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 291; E-Value: 1e-163
Query Start/End: Original strand, 18 - 332
Target Start/End: Complemental strand, 9700082 - 9699768
Alignment:
| Q |
18 |
aattgctggcatgggattcttcactgatgcctatgatctgttctgcatttcaaccgtttcgaagctcttgggacgattatattactttgatccaagcact |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9700082 |
aattgctggcatgggattcttcactgatgcctatgatctgttctgcatttcaaccgtttcgaagctcttgggacgattatattactttgatccaagcact |
9699983 |
T |
|
| Q |
118 |
aacaaaccagggaagcttccaccaacaattaataacttagtcaccggtgtggcccttgtcggaacactttctggccaattagtcttcggctggctcggag |
217 |
Q |
| |
|
|||||||||||||||||||||||| || ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9699982 |
aacaaaccagggaagcttccaccatcagttaataatgtagtcaccggtgtggcccttgtcggaacactttctggccaattagtcttcggctggctcggag |
9699883 |
T |
|
| Q |
218 |
acaaacttggacgcaagaaagtttatggtgtcacactcattatcatggttgcttgtgccatttgctctggtctttcttttggttcttccccgaaatctgt |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
9699882 |
acaaacttggacgcaagaaagtttatggtgtcacactcattatcatggttgcttgtgccatttgctctggtctttcttttggttcttccgcgaaatctgt |
9699783 |
T |
|
| Q |
318 |
tatgttaaccctttg |
332 |
Q |
| |
|
|||| |||||||||| |
|
|
| T |
9699782 |
tatgataaccctttg |
9699768 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 19 - 68
Target Start/End: Original strand, 16223247 - 16223296
Alignment:
| Q |
19 |
attgctggcatgggattcttcactgatgcctatgatctgttctgcatttc |
68 |
Q |
| |
|
|||||||| |||||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
16223247 |
attgctggaatgggattcttcactgatgcatatgatcttttctgcatttc |
16223296 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 22 - 68
Target Start/End: Original strand, 16183860 - 16183906
Alignment:
| Q |
22 |
gctggcatgggattcttcactgatgcctatgatctgttctgcatttc |
68 |
Q |
| |
|
||||| |||||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
16183860 |
gctggaatgggattcttcactgatgcatatgatcttttctgcatttc |
16183906 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 22 - 68
Target Start/End: Complemental strand, 16175502 - 16175456
Alignment:
| Q |
22 |
gctggcatgggattcttcactgatgcctatgatctgttctgcatttc |
68 |
Q |
| |
|
||||| ||||| |||||||||||||| |||||||| ||||||||||| |
|
|
| T |
16175502 |
gctggaatgggtttcttcactgatgcttatgatcttttctgcatttc |
16175456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 19 - 68
Target Start/End: Original strand, 33108957 - 33109006
Alignment:
| Q |
19 |
attgctggcatgggattcttcactgatgcctatgatctgttctgcatttc |
68 |
Q |
| |
|
|||||||| ||||| || |||||||||||||||||||| || |||||||| |
|
|
| T |
33108957 |
attgctggaatgggttttttcactgatgcctatgatctcttttgcatttc |
33109006 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 19 - 68
Target Start/End: Original strand, 33114995 - 33115044
Alignment:
| Q |
19 |
attgctggcatgggattcttcactgatgcctatgatctgttctgcatttc |
68 |
Q |
| |
|
|||||||| ||||| || ||||||||| |||||||||| ||||||||||| |
|
|
| T |
33114995 |
attgctggaatgggttttttcactgattcctatgatctcttctgcatttc |
33115044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 19 - 65
Target Start/End: Original strand, 38893057 - 38893103
Alignment:
| Q |
19 |
attgctggcatgggattcttcactgatgcctatgatctgttctgcat |
65 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
38893057 |
attgctggaatgggattctttactgatgcctatgatctgttctgcat |
38893103 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 22 - 62
Target Start/End: Original strand, 38883868 - 38883908
Alignment:
| Q |
22 |
gctggcatgggattcttcactgatgcctatgatctgttctg |
62 |
Q |
| |
|
||||| ||||||||||| || |||||||||||||||||||| |
|
|
| T |
38883868 |
gctggtatgggattctttacagatgcctatgatctgttctg |
38883908 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University