View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9879_high_43 (Length: 327)
Name: NF9879_high_43
Description: NF9879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9879_high_43 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 229; Significance: 1e-126; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 327
Target Start/End: Complemental strand, 48085528 - 48085222
Alignment:
| Q |
1 |
attttattactgacaatttgagtgggaaaaccagtactcaagaacttggcatgacaaaccactagctatggaatacaaaacaaaagattaatggataaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48085528 |
attttattactgacaatttgagtgggaaaaccagtactcaagaacttggcatgacaaaccactagctatggaatacaaaacaaaag-------------- |
48085443 |
T |
|
| Q |
101 |
taaagggacacagataaagaaaatacacacataaactaacnnnnnnncattaaccaaatgtcttggatggattgatcaagtcctggaatctaaggccatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48085442 |
------gacacagataaagaaaatacacacataaactaacaaaaaaacattaaccaaatgtcttggatggattgatcaagtcctggaatctaaggccatg |
48085349 |
T |
|
| Q |
201 |
atagtgctgagattcatgggatacatgtactgagcactgcccctaaggatttggttgactatgattttgtttgccttttcagatggatggaatgcatccc |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48085348 |
atagtgctgagattcatgggatacatgtactgagcactgcccctaaggattcggttgactatgattttgtttgccttttcagatggatggaatgcatccc |
48085249 |
T |
|
| Q |
301 |
taaatgcattaagttctctgtttgggc |
327 |
Q |
| |
|
||| |||||||||||||||||||||| |
|
|
| T |
48085248 |
aaaaagcattaagttctctgtttgggc |
48085222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 264 - 309
Target Start/End: Complemental strand, 48102536 - 48102491
Alignment:
| Q |
264 |
attttgtttgccttttcagatggatggaatgcatccctaaatgcat |
309 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
48102536 |
attttgtttgccttttcagatggatggaatgcatcccaaaatgcat |
48102491 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 267 - 310
Target Start/End: Original strand, 7385568 - 7385611
Alignment:
| Q |
267 |
ttgtttgccttttcagatggatggaatgcatccctaaatgcatt |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
7385568 |
ttgtttgccttttcagatggatggaatgcatcccaaaatgcatt |
7385611 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 257 - 309
Target Start/End: Original strand, 35357711 - 35357763
Alignment:
| Q |
257 |
gactatgattttgtttgccttttcagatggatggaatgcatccctaaatgcat |
309 |
Q |
| |
|
|||||||||| || | || |||||||||||||| |||||||||| |||||||| |
|
|
| T |
35357711 |
gactatgattctgctagctttttcagatggatgaaatgcatcccaaaatgcat |
35357763 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 258 - 318
Target Start/End: Original strand, 35376267 - 35376327
Alignment:
| Q |
258 |
actatgattttgtttgccttttcagatggatggaatgcatccctaaatgcattaagttctc |
318 |
Q |
| |
|
||||||||| || | || ||||||||||||||||||| ||||| |||||||| ||| |||| |
|
|
| T |
35376267 |
actatgattctgctagctttttcagatggatggaatggatcccaaaatgcataaaggtctc |
35376327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University