View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9879_high_43 (Length: 327)

Name: NF9879_high_43
Description: NF9879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9879_high_43
NF9879_high_43
[»] chr7 (2 HSPs)
chr7 (1-327)||(48085222-48085528)
chr7 (264-309)||(48102491-48102536)
[»] chr6 (1 HSPs)
chr6 (267-310)||(7385568-7385611)
[»] chr1 (2 HSPs)
chr1 (257-309)||(35357711-35357763)
chr1 (258-318)||(35376267-35376327)


Alignment Details
Target: chr7 (Bit Score: 229; Significance: 1e-126; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 327
Target Start/End: Complemental strand, 48085528 - 48085222
Alignment:
1 attttattactgacaatttgagtgggaaaaccagtactcaagaacttggcatgacaaaccactagctatggaatacaaaacaaaagattaatggataaat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||                  
48085528 attttattactgacaatttgagtgggaaaaccagtactcaagaacttggcatgacaaaccactagctatggaatacaaaacaaaag-------------- 48085443  T
101 taaagggacacagataaagaaaatacacacataaactaacnnnnnnncattaaccaaatgtcttggatggattgatcaagtcctggaatctaaggccatg 200  Q
          ||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||||||||||||||||||    
48085442 ------gacacagataaagaaaatacacacataaactaacaaaaaaacattaaccaaatgtcttggatggattgatcaagtcctggaatctaaggccatg 48085349  T
201 atagtgctgagattcatgggatacatgtactgagcactgcccctaaggatttggttgactatgattttgtttgccttttcagatggatggaatgcatccc 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
48085348 atagtgctgagattcatgggatacatgtactgagcactgcccctaaggattcggttgactatgattttgtttgccttttcagatggatggaatgcatccc 48085249  T
301 taaatgcattaagttctctgtttgggc 327  Q
     ||| ||||||||||||||||||||||    
48085248 aaaaagcattaagttctctgtttgggc 48085222  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 264 - 309
Target Start/End: Complemental strand, 48102536 - 48102491
Alignment:
264 attttgtttgccttttcagatggatggaatgcatccctaaatgcat 309  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||    
48102536 attttgtttgccttttcagatggatggaatgcatcccaaaatgcat 48102491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 267 - 310
Target Start/End: Original strand, 7385568 - 7385611
Alignment:
267 ttgtttgccttttcagatggatggaatgcatccctaaatgcatt 310  Q
    |||||||||||||||||||||||||||||||||| |||||||||    
7385568 ttgtttgccttttcagatggatggaatgcatcccaaaatgcatt 7385611  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 257 - 309
Target Start/End: Original strand, 35357711 - 35357763
Alignment:
257 gactatgattttgtttgccttttcagatggatggaatgcatccctaaatgcat 309  Q
    |||||||||| || | || |||||||||||||| |||||||||| ||||||||    
35357711 gactatgattctgctagctttttcagatggatgaaatgcatcccaaaatgcat 35357763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 258 - 318
Target Start/End: Original strand, 35376267 - 35376327
Alignment:
258 actatgattttgtttgccttttcagatggatggaatgcatccctaaatgcattaagttctc 318  Q
    ||||||||| || | || ||||||||||||||||||| ||||| |||||||| ||| ||||    
35376267 actatgattctgctagctttttcagatggatggaatggatcccaaaatgcataaaggtctc 35376327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University