View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9879_high_56 (Length: 293)
Name: NF9879_high_56
Description: NF9879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9879_high_56 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 15 - 279
Target Start/End: Original strand, 13578795 - 13579059
Alignment:
| Q |
15 |
gacgaaaatggtggaaagtgatgaacaaaaacgaagccccgtgatccgaaagaaaacagcgacgaatagccaaaacatggcttcacttattagtccgaga |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13578795 |
gacgaaaatggtggaaagtgatgaacaaaaacgaagccccgtgatccgaaagaaaacagcgacgaatagccaaaacatggcttcacttattagtccgaga |
13578894 |
T |
 |
| Q |
115 |
ttcaaatctgctgctgctatggctggttgggatgaagaagcgctgttacttgcaaccctaattgttgaagatacccctgatcgagatcgagattctaaac |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
13578895 |
ttcaaatctgctgctgctatggctggttgggatgaagaagcgctgttacttgcaaccctaattgttgaagatacccctgatcgagatcgaaattctaaac |
13578994 |
T |
 |
| Q |
215 |
agaaaagacgttttgttttgaattcgaaatctccgctctccaattcatcaaggtaatcatgattt |
279 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13578995 |
agaagagacgttttgttttgaattcgaaatctccgctctccaattcatcaaggtaatcatgattt |
13579059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University