View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9879_high_79 (Length: 242)

Name: NF9879_high_79
Description: NF9879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9879_high_79
NF9879_high_79
[»] chr3 (1 HSPs)
chr3 (14-226)||(42113438-42113650)


Alignment Details
Target: chr3 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 14 - 226
Target Start/End: Complemental strand, 42113650 - 42113438
Alignment:
14 gcagagattggcttgttgagtaatatctagagagggtgaaagtggatatagatattttctccggaaaaaaggtaaccggaaaagttcaatgatgcaccag 113  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42113650 gcagagattggcttgttgagtaatatctagggagggtgaaagtggatatagatattttctccggaaaaaaggtaaccggaaaagttcaatgatgcaccag 42113551  T
114 aagaagatgaaaagtacgaggaggaaacgtacggtccaaagagagttaaagccttgaagataggttaaagattttgatttcaaacggagatggaaaataa 213  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42113550 aagaagatgaaaagtacgaggaggaaacgtacggtccaaagagagttaaagccttgaagataggttaaagattttgatttcaaacggagatggaaaataa 42113451  T
214 aacaaagagataa 226  Q
    |||||||||||||    
42113450 aacaaagagataa 42113438  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University