View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9879_high_82 (Length: 240)
Name: NF9879_high_82
Description: NF9879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9879_high_82 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 18 - 207
Target Start/End: Original strand, 14925722 - 14925911
Alignment:
| Q |
18 |
ttaactgttctaattccactactttatcctttgtcatctgtgtccaggattactgcatgatgttggtcatgggcccttcagccacacttttgagcgcggg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14925722 |
ttaactgttctaattccactactttatcctttgtcatctgtgtccaggattactgcatgatgttggtcatgggcccttcagccacacttttgagcgcggg |
14925821 |
T |
 |
| Q |
118 |
ttccttcccctggttcttaatggccccacttggtaattttagtgtaatgataaaagaaagtacatgttgattttccgcttttaataatac |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
14925822 |
ttccttcccctggttcttaatggccccacttggtaattttagtgtaatgctaaaagaaagtacatgttgattttctgcttttaataatac |
14925911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University