View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9879_high_89 (Length: 239)
Name: NF9879_high_89
Description: NF9879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9879_high_89 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 38 - 223
Target Start/End: Complemental strand, 43408191 - 43408007
Alignment:
| Q |
38 |
ttatcttgcgtgtactaattatgaaaactaaatataataattttttattgaaaacaatgctttaaaaactttatacctttttatcgaacacaagcaaaga |
137 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
43408191 |
ttatcttgcgtgtactaattatgaaaactaaatataataattttttattgaaaacaatgcttttaaaactttatacctttttatcgaacacaagcaaaga |
43408092 |
T |
 |
| Q |
138 |
aaatgtgtgctgcattaagcgattaaaatgagannnnnnnagtgatccattgacataagttgttgagatgcggatgaggacggtgc |
223 |
Q |
| |
|
||||||||||||||||| |||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43408091 |
aaatgtgtgctgcattacgcgattaagatgaga-ggggggagtgatccattgacataagttgttgagatgcggatgaggacggtgc |
43408007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University