View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9879_high_95 (Length: 224)
Name: NF9879_high_95
Description: NF9879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9879_high_95 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 20 - 208
Target Start/End: Original strand, 410766 - 410953
Alignment:
| Q |
20 |
caaagaagcacaggttttgtttttctttaatatcctacttccatttgttttagctcacattatttcctgaccaagttgtttttcttaccaattttgactc |
119 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
410766 |
caaagaagcacaggttt-gtttttctttaatatcctacttccatttgttttagctcacattatttccttaccaagttgtttttcttaccaattttgactc |
410864 |
T |
 |
| Q |
120 |
aataggagggtgtggctattgaaatagcagaggctgttgttggtgcattgaatggtgaactttcagcaactgctgtcaatgctcctatg |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
410865 |
aataggagggtgtggctattgaaatagcagaggctgttgttggtgcattgaatggtgaactttcagcaactgctgtcaatgctcctatg |
410953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 123 - 171
Target Start/End: Original strand, 48786060 - 48786108
Alignment:
| Q |
123 |
aggagggtgtggctattgaaatagcagaggctgttgttggtgcattgaa |
171 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||||||||| || ||||| |
|
|
| T |
48786060 |
aggaaggtgtggctattgaaatagcagaagctgttgttggggctttgaa |
48786108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University