View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9879_low_107 (Length: 241)
Name: NF9879_low_107
Description: NF9879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9879_low_107 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 15 - 224
Target Start/End: Original strand, 8742838 - 8743047
Alignment:
| Q |
15 |
aaaggccatgcaaaaactctttcattaggctccaaatgtagcaactcacgtgaaaaatcagcttgggctgattgtgttgagctatatgaacaaaccatcc |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8742838 |
aaaggccatgcaaaaactctttcattaggctccaaatgtagtaactcacgtgaaaaatcagcttgggctgattgtgttgagctatatgaacaaaccatcc |
8742937 |
T |
 |
| Q |
115 |
ttaagctcaacaaaaccctaaaccctaaaacaaagtgttctcaagttgatgctcaaacatggctaagcactgctctcaccaaccttgagacatgtaaagc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8742938 |
ttaagctcaacaaaaccctaaaccctaaaacaaagtgttctcaagttgatgctcaaacatggctaagcactgctctcaccaaccttgagacatgtaaagc |
8743037 |
T |
 |
| Q |
215 |
tggattctac |
224 |
Q |
| |
|
|||||||||| |
|
|
| T |
8743038 |
tggattctac |
8743047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University