View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9879_low_113 (Length: 240)
Name: NF9879_low_113
Description: NF9879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9879_low_113 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 30 - 240
Target Start/End: Complemental strand, 42332585 - 42332384
Alignment:
| Q |
30 |
tcctaacatagttaatggccctttgcctacctctaactggttctcagatggtgtggtgaaagtggtcgagatgggtaattgagtttattttggttagatg |
129 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42332585 |
tcctaacatagttaatggcccttggcctacctctaactggttctcagatggtgtggtgaaagtggtcgagatgggtaattgagtttattttggttagatg |
42332486 |
T |
 |
| Q |
130 |
tttgggtaagaaatttaggttttggggaagaggtggatttgaatgctctcttggaggagacctctttctttctatctgggatcaacttttgttggaaaat |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42332485 |
tttgggtaagaaatttaggttttggggaagaggtggatttgaatgctctcttggaggagacctcttt---------tgggatcaacttttgttggaaaaa |
42332395 |
T |
 |
| Q |
230 |
ttgatgaagct |
240 |
Q |
| |
|
||||||||||| |
|
|
| T |
42332394 |
ttgatgaagct |
42332384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University