View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9879_low_123 (Length: 231)
Name: NF9879_low_123
Description: NF9879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9879_low_123 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 106; Significance: 3e-53; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 105 - 210
Target Start/End: Complemental strand, 14495281 - 14495176
Alignment:
| Q |
105 |
agtgcaacaaagtgttgtacaatgtctagtcttagttaacaacatgcaccactttattcactttaatactttgggacattacacgcatgcctagtgaatt |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14495281 |
agtgcaacaaagtgttgtacaatgtctagtcttagttaacaacatgcaccactttattcactttaatactttgggacattacacgcatgcctagtgaatt |
14495182 |
T |
|
| Q |
205 |
cgaata |
210 |
Q |
| |
|
|||||| |
|
|
| T |
14495181 |
cgaata |
14495176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 12 - 52
Target Start/End: Complemental strand, 14495374 - 14495334
Alignment:
| Q |
12 |
agaagcataggggaagttattttatgttttcattccaagat |
52 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
14495374 |
agaagtataggggaagttattttatgttttcattccaagat |
14495334 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University