View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9879_low_124 (Length: 231)
Name: NF9879_low_124
Description: NF9879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9879_low_124 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 40531478 - 40531258
Alignment:
| Q |
1 |
ttaaaatatcccctacaaaactgaaggtgtttgctaatcagaacatttttagcttggtattattgaagcaaaattgcaaggagaaagaggcgtagtgagt |
100 |
Q |
| |
|
||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
40531478 |
ttaaaatatcccctacaaa-ctgaaggtttttgctaatcagaacatttttagcttggtattattgaagcaaaattgcaaggagaaagaggcgtggtgagt |
40531380 |
T |
 |
| Q |
101 |
ggatatgctggttgatccgttgcaagaaca-gatgcaattttatataggtacttgatatcagacgtataatttcgagcatatcttatatagtttttaatt |
199 |
Q |
| |
|
|||| ||||| ||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
40531379 |
ggatttgctgtttgatccgttgcaagaacatgatgcaattttatataggaacttgatatcagacgtataatttcgagcatattttatatagtttttaatt |
40531280 |
T |
 |
| Q |
200 |
tgatatttcttctttctctctg |
221 |
Q |
| |
|
|||||||| ||||||||||||| |
|
|
| T |
40531279 |
tgatatttgttctttctctctg |
40531258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University