View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9879_low_125 (Length: 230)
Name: NF9879_low_125
Description: NF9879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9879_low_125 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 10055338 - 10055116
Alignment:
| Q |
1 |
tacctggttggtaatcagagaaacatacaacttgattgctgttaatgctttcaaatccacacattagctgatgtgattcacaataactgcagtcaggttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10055338 |
tacctggttggtaatcagagaaacatacaacttgattgctgttaatgctttcaaatccacacattagctgatgtgattcacaataactgcagtcaggttt |
10055239 |
T |
|
| Q |
101 |
atcccatgttaattgaagatctgcactaaggtcatctctgagattttcatgaaaccgttctggtcttgcaattggaactgaaagattttttataacagag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10055238 |
atcccatgttaattgaagatctgcactaaggtcatctctgagattttcttgaaaccgttctggtcttgcaattggaactgaaagattttttataacagag |
10055139 |
T |
|
| Q |
201 |
caaccagatagagaattgacaaa |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
10055138 |
caaccagatagagaattgacaaa |
10055116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University