View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9879_low_128 (Length: 228)

Name: NF9879_low_128
Description: NF9879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9879_low_128
NF9879_low_128
[»] chr5 (3 HSPs)
chr5 (87-228)||(22369189-22369331)
chr5 (1-54)||(22369364-22369417)
chr5 (169-227)||(40798150-40798210)
[»] scaffold0022 (1 HSPs)
scaffold0022 (169-227)||(152292-152352)
[»] chr7 (1 HSPs)
chr7 (169-227)||(39701126-39701186)


Alignment Details
Target: chr5 (Bit Score: 107; Significance: 9e-54; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 87 - 228
Target Start/End: Complemental strand, 22369331 - 22369189
Alignment:
87 acagttattagttaattgctttctattatgtgaagtaagcgcacacatcttttgcacacttttnnnnnnnn-ttgtagtttctgattattgaatttttta 185  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||          ||||||||||||||||||||||||||||    
22369331 acagttattagttaattgctttctattatgtgaagtaagcgcacacatcttttgcacactttaaaaaaaaaattgtagtttctgattattgaatttttta 22369232  T
186 aaatctgcaagtttatgtttgtttcagtctgatttttgttgtt 228  Q
    |||||||||||||||||||||||||||||||||||||||||||    
22369231 aaatctgcaagtttatgtttgtttcagtctgatttttgttgtt 22369189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 1 - 54
Target Start/End: Complemental strand, 22369417 - 22369364
Alignment:
1 tagatatccttcatatcattttcaatatagtcaaaggtatcggttagtactcca 54  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||||||    
22369417 tagatatccttcatatcattttcaatatagtcaaagatatcggttagtactcca 22369364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 169 - 227
Target Start/End: Original strand, 40798150 - 40798210
Alignment:
169 gattattgaattttttaaaatctgcaag--tttatgtttgtttcagtctgatttttgttgt 227  Q
    ||||||||||||||||||||||||||||  | ||||||||||||| | |||||||||||||    
40798150 gattattgaattttttaaaatctgcaagtatatatgtttgtttcaatttgatttttgttgt 40798210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0022 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: scaffold0022
Description:

Target: scaffold0022; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 169 - 227
Target Start/End: Complemental strand, 152352 - 152292
Alignment:
169 gattattgaattttttaaaatctgcaagtt--tatgtttgtttcagtctgatttttgttgt 227  Q
    ||||||||| |||||||||||||||||||   |||||||||||||||||||||||||||||    
152352 gattattgatttttttaaaatctgcaagtaaatatgtttgtttcagtctgatttttgttgt 152292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 169 - 227
Target Start/End: Original strand, 39701126 - 39701186
Alignment:
169 gattattgaattttttaaaatctgcaagtt--tatgtttgtttcagtctgatttttgttgt 227  Q
    ||||||||| |||||||||||||||||||   |||||||||||||||||||||||||||||    
39701126 gattattgatttttttaaaatctgcaagtaaatatgtttgtttcagtctgatttttgttgt 39701186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University