View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9879_low_128 (Length: 228)
Name: NF9879_low_128
Description: NF9879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9879_low_128 |
 | |
|
| [»] chr5 (3 HSPs) |
| |
|
| [»] scaffold0022 (1 HSPs) |
| | |
|
Alignment Details
Target: chr5 (Bit Score: 107; Significance: 9e-54; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 87 - 228
Target Start/End: Complemental strand, 22369331 - 22369189
Alignment:
| Q |
87 |
acagttattagttaattgctttctattatgtgaagtaagcgcacacatcttttgcacacttttnnnnnnnn-ttgtagtttctgattattgaatttttta |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
22369331 |
acagttattagttaattgctttctattatgtgaagtaagcgcacacatcttttgcacactttaaaaaaaaaattgtagtttctgattattgaatttttta |
22369232 |
T |
|
| Q |
186 |
aaatctgcaagtttatgtttgtttcagtctgatttttgttgtt |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22369231 |
aaatctgcaagtttatgtttgtttcagtctgatttttgttgtt |
22369189 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 1 - 54
Target Start/End: Complemental strand, 22369417 - 22369364
Alignment:
| Q |
1 |
tagatatccttcatatcattttcaatatagtcaaaggtatcggttagtactcca |
54 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
22369417 |
tagatatccttcatatcattttcaatatagtcaaagatatcggttagtactcca |
22369364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 169 - 227
Target Start/End: Original strand, 40798150 - 40798210
Alignment:
| Q |
169 |
gattattgaattttttaaaatctgcaag--tttatgtttgtttcagtctgatttttgttgt |
227 |
Q |
| |
|
|||||||||||||||||||||||||||| | ||||||||||||| | ||||||||||||| |
|
|
| T |
40798150 |
gattattgaattttttaaaatctgcaagtatatatgtttgtttcaatttgatttttgttgt |
40798210 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0022 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: scaffold0022
Description:
Target: scaffold0022; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 169 - 227
Target Start/End: Complemental strand, 152352 - 152292
Alignment:
| Q |
169 |
gattattgaattttttaaaatctgcaagtt--tatgtttgtttcagtctgatttttgttgt |
227 |
Q |
| |
|
||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
152352 |
gattattgatttttttaaaatctgcaagtaaatatgtttgtttcagtctgatttttgttgt |
152292 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 169 - 227
Target Start/End: Original strand, 39701126 - 39701186
Alignment:
| Q |
169 |
gattattgaattttttaaaatctgcaagtt--tatgtttgtttcagtctgatttttgttgt |
227 |
Q |
| |
|
||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
39701126 |
gattattgatttttttaaaatctgcaagtaaatatgtttgtttcagtctgatttttgttgt |
39701186 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University