View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9879_low_134 (Length: 216)
Name: NF9879_low_134
Description: NF9879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9879_low_134 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 165; Significance: 2e-88; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 14 - 198
Target Start/End: Complemental strand, 31213646 - 31213463
Alignment:
| Q |
14 |
agcacagaaagcgagaagtaggcataactgaaatatgtttatactaagggatggagggagtacttgttttgaaccgaggaatttccaccgtacatcattt |
113 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31213646 |
agcactgaaagcgagaagtaggcataactgaaatatgtttatactaagg-acggagggagtacttgttttgaaccgaggaatttccaccgtacatcattt |
31213548 |
T |
|
| Q |
114 |
gtgggtttaattgctccaaatcctccttaaatatccatcgataaccacaatttttgacctctaaatgcaatctggggggatgcac |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31213547 |
gtgggtttaattgctccaaatcctccttaaatatccatcgataacctcaatttttgacctctaaatgcaatctggggggatgcac |
31213463 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 65; E-Value: 9e-29
Query Start/End: Original strand, 83 - 183
Target Start/End: Complemental strand, 31248002 - 31247902
Alignment:
| Q |
83 |
tgaaccgaggaatttccaccgtacatcatttgtgggtttaattgctccaaatcctccttaaatatccatcgataaccacaatttttgacctctaaatgca |
182 |
Q |
| |
|
||||| ||||||||||||| ||||||||||||||||||||| || |||| |||||||||||||||||| |||||||||||||||| ||||| ||||||| |
|
|
| T |
31248002 |
tgaactgaggaatttccactgtacatcatttgtgggtttaaatgttccagatcctccttaaatatccaatgataaccacaattttttacctccaaatgca |
31247903 |
T |
|
| Q |
183 |
a |
183 |
Q |
| |
|
| |
|
|
| T |
31247902 |
a |
31247902 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 106 - 183
Target Start/End: Original strand, 31264087 - 31264164
Alignment:
| Q |
106 |
catcatttgtgggtttaattgctccaaatcctccttaaatatccatcgataaccacaatttttgacctctaaatgcaa |
183 |
Q |
| |
|
||||||||| | |||||| || |||| |||||||||||||||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
31264087 |
catcatttgcgcgtttaaatgttccagatcctccttaaatatccaatgataaccacaatttttgacctccaaatgcaa |
31264164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 111 - 183
Target Start/End: Complemental strand, 31304872 - 31304800
Alignment:
| Q |
111 |
tttgtgggtttaattgctccaaatcctccttaaatatccatcgataaccacaatttttgacctctaaatgcaa |
183 |
Q |
| |
|
||||||||||||||||||||| |||||||| ||||||||||| |||||||| || || ||||| |||||||| |
|
|
| T |
31304872 |
tttgtgggtttaattgctccagatcctcctcaaatatccatctgtaaccacagttctttacctcaaaatgcaa |
31304800 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 78 - 163
Target Start/End: Complemental strand, 13615741 - 13615656
Alignment:
| Q |
78 |
tgttttgaaccgaggaatttccaccgtacatcattt--gtgggtttaattgctccaaatcctccttaaatatccatcgataaccacaa |
163 |
Q |
| |
|
|||||||||| |||||||||||| | || ||||||| | ||||||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
13615741 |
tgttttgaactgaggaatttccaac-ta-atcatttgcgggggtttaattgctccaaatcctcctcaaatatccaacgataaccacaa |
13615656 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University