View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9879_low_141 (Length: 204)

Name: NF9879_low_141
Description: NF9879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9879_low_141
NF9879_low_141
[»] chr8 (1 HSPs)
chr8 (107-189)||(2065041-2065123)


Alignment Details
Target: chr8 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 107 - 189
Target Start/End: Complemental strand, 2065123 - 2065041
Alignment:
107 ttaatactctagaccttctcttcacaaaaacgtcgtcgttatggatactacatttacaccaccgtcaccacaccgttcatctc 189  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2065123 ttaatactctagaccttctcttcacaaaaacgtcgtcgttatggatactacatttacaccaccgtcaccacaccgttcatctc 2065041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University