View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9879_low_144 (Length: 203)
Name: NF9879_low_144
Description: NF9879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9879_low_144 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 3e-90; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 20 - 195
Target Start/End: Complemental strand, 6029556 - 6029381
Alignment:
| Q |
20 |
tccactaggttgttctcttcttcctcttcttcctccaagatgtctccttcatcttcagtgttttcccattcgaacataaattgaaatttctcactagggt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6029556 |
tccactaggttgttctcttcttcctcttcttcctccaagatgtctccttcatcttcagtgttttcccattcgaacataaattgaaatttctcactagggt |
6029457 |
T |
|
| Q |
120 |
tgataacacgcatcttaggttttttcgaaccttgctttttctcctgctcacactcccctaggttgttctctgcttc |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
6029456 |
tgataacacgcatcttaggttttttcgaaccttgcgttttctcctgctcacactcccctaggttgttctcttcttc |
6029381 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 81; E-Value: 2e-38
Query Start/End: Original strand, 71 - 183
Target Start/End: Complemental strand, 6029370 - 6029258
Alignment:
| Q |
71 |
tcttcagtgttttcccattcgaacataaattgaaatttctcactagggttgataacacgcatcttaggttttttcgaaccttgctttttctcctgctcac |
170 |
Q |
| |
|
|||||||||| ||||||||||||| ||||| |||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
6029370 |
tcttcagtgtcttcccattcgaacgtaaatcgaaatttctcactaggcttgataacacgcatcttaggttttttcaaaccttgctttttctgatgctcac |
6029271 |
T |
|
| Q |
171 |
actcccctaggtt |
183 |
Q |
| |
|
||||| ||||||| |
|
|
| T |
6029270 |
actccgctaggtt |
6029258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 71 - 189
Target Start/End: Complemental strand, 6034495 - 6034377
Alignment:
| Q |
71 |
tcttcagtgttttcccattcgaacataaattgaaatttctcactagggttgataacacgcatcttaggttttttcgaaccttgctttttctcctgctcac |
170 |
Q |
| |
|
||||||||||||||||| |||||| ||||| |||||||||| ||||| || ||||||||||||||||||||||||||||| ||||||||| |||| || |
|
|
| T |
6034495 |
tcttcagtgttttcccaatcgaacgtaaatcgaaatttctcgctaggtttagtaacacgcatcttaggttttttcgaacctagctttttcttatgcttac |
6034396 |
T |
|
| Q |
171 |
actcccctaggttgttctc |
189 |
Q |
| |
|
||||| ||||||| ||||| |
|
|
| T |
6034395 |
actccgctaggttattctc |
6034377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 82 - 195
Target Start/End: Complemental strand, 6029641 - 6029534
Alignment:
| Q |
82 |
ttcccattcgaacataaattgaaatttctcactagggttgataacacgcatcttaggttttttcgaaccttgctttttctcctgctcacactcccctagg |
181 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||| || |||||||||||||||||||||||| ||||| ||||||| |||||||||| ||||| |
|
|
| T |
6029641 |
ttcccattcgaaagtaaatcgaaatttctcactaggtttaataacacgcatcttaggttttttcaaacctagcttttt------ctcacactccactagg |
6029548 |
T |
|
| Q |
182 |
ttgttctctgcttc |
195 |
Q |
| |
|
||||||||| |||| |
|
|
| T |
6029547 |
ttgttctcttcttc |
6029534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University