View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9879_low_26 (Length: 411)
Name: NF9879_low_26
Description: NF9879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9879_low_26 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 51 - 268
Target Start/End: Original strand, 47145163 - 47145376
Alignment:
| Q |
51 |
cgtgtgtgtctttcattcgctcgctcgctccgaagaaacttcttccttctgcttcttgtcctctcctctgtatgtatgtatgtggttgtgttgataacaa |
150 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47145163 |
cgtgtgtgtctttcattcgc----tcgctccgaagaaacttcttccttctgcttcttgtcctctcctctgtatgtatgtatgtggttgtgttgataacaa |
47145258 |
T |
 |
| Q |
151 |
atagtaacaacaatatatggtgatgatgattactgcttggatcactgacctcttcgcttgcatggggtgagtcactcactcccctccctatgtattccct |
250 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47145259 |
atagtaacaacaatagatggtgatgatgattactgcttggatcactgacctcttcgcttgcatggggtgagtcactcactcccctccctatgtattccct |
47145358 |
T |
 |
| Q |
251 |
tcttctttattttctatt |
268 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
47145359 |
tcttctttattttctatt |
47145376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 297 - 393
Target Start/End: Original strand, 47145376 - 47145472
Alignment:
| Q |
297 |
tatagccatagtattacactagatttggaattatttccaatcatttcaattcaattattcactttccacttctgcctaaatggctgtttctcctgtt |
393 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47145376 |
tatagccataggattagactagatttggaattatttccaatcaattcaattcaattattcactttccacttctgcctaaatggctgtttctcctgtt |
47145472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University