View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9879_low_35 (Length: 368)
Name: NF9879_low_35
Description: NF9879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9879_low_35 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 103 - 358
Target Start/End: Original strand, 8035831 - 8036086
Alignment:
| Q |
103 |
ctattcatggcatccaacaccaccacccttcacaaacaagtccattcctccggccattccattattccaacggcactccatcgtcagaaacatcgaaatt |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
8035831 |
ctattcatggcatccaacaccaccacccttcacaaccaagtccattcctccggccattccattattccaacagcactccatcgtcagaaacatcgaaatt |
8035930 |
T |
|
| Q |
203 |
cagccatcgccgtcgctcttcgccgtagaggtactcataagaaatattcaggtattagctcccctgtaaatttcagacaaggtttcttgaaaaatgagat |
302 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
8035931 |
cagccatcgccatcgctcttcgccgtagaggtactcataagaaatattcaggtattagctcccctgtgaatttcagacaaggtttcgtgaaaaatgagat |
8036030 |
T |
|
| Q |
303 |
ttctgctaggaagctcgcagctggtttgtggcagttgcggtttgttgaagtctctg |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8036031 |
ttctgctaggaagctcgcagctggtttgtggcagttgcggtttgttgaagtctctg |
8036086 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University