View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9879_low_48 (Length: 342)
Name: NF9879_low_48
Description: NF9879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9879_low_48 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 1 - 324
Target Start/End: Original strand, 5834581 - 5834897
Alignment:
| Q |
1 |
ctacgtctcctattgcagagcaactatagtatatctctgctaagcttagggttcagagtgtaacctttgtttaaatattgcggtccaatttacaatatta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
5834581 |
ctacgtctcctattgcagagcaactatagtatatctctactaagcttagggttcagagtgtaacctttgtttaaatattgcggttcaatttacaatatta |
5834680 |
T |
|
| Q |
101 |
tccatgaactctnnnnnnnnnnnnnnnnnnccatgaactcaccccgctcgagtgatttgtccacttatcagtaaactgagtcatacccttaattctaggt |
200 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5834681 |
tccatgaactctaaaaaaaaataa------ccatgaactcaccc-gctcgagtgatctgtccacttatcagtaaactgagtcatacccttaattctaggt |
5834773 |
T |
|
| Q |
201 |
tttgtttctatatttgcactgcaaattctaactaaaaccacaactaatgaaattgactgcaaaaatattggaatttcttgacaaagaactagcatcttta |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
5834774 |
tttgtttctatatttgcactgcaaattctaactaaaaccacaactaatgaaattgactgcacaaataatggaatttcttgacaaagaactagcatcttta |
5834873 |
T |
|
| Q |
301 |
taagtcaattttggggggaattag |
324 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
5834874 |
taagtcaattttggggggaattag |
5834897 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University