View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9879_low_50 (Length: 336)
Name: NF9879_low_50
Description: NF9879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9879_low_50 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 19 - 321
Target Start/End: Original strand, 3853005 - 3853307
Alignment:
| Q |
19 |
ggttttgttcattttcagaagaagnnnnnnntgagaataagttagtaggagtgtggtgaggttgtgtttgtgattgggggtttggaagagaaagacggag |
118 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
3853005 |
ggttttgttcattttcagaagaagaaaaaaatgagaataagttagtaggagtgtggtgaggttgtgtttgtggttgggggtttggaagagaaagacggag |
3853104 |
T |
|
| Q |
119 |
ggtggcaaaatgagctttcatatgtccacccaatgctttaccattgatgaatgttcttgagcaaagcttgcatttgtacctctccatttggcattgcata |
218 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3853105 |
ggtggcaaaatgagctttcatgtgtccacccaatgctttaccattgatgaatgttcttgagcaaagcttgcatttgtacctctccatttggcattgcata |
3853204 |
T |
|
| Q |
219 |
gagagaaaaaggtagaaaactagaaaggctttttattgtgatagaatatgtttagaggaatttggaaactaaaaagagtagcagctcacaagaatcccac |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3853205 |
gagagaaaaaggtagaaaactagaaaggctttttattgtgatagaatatgtttagaggaatttggaaactaaaaagagtagcagctcacaagaatcccac |
3853304 |
T |
|
| Q |
319 |
cac |
321 |
Q |
| |
|
||| |
|
|
| T |
3853305 |
cac |
3853307 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University