View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9879_low_55 (Length: 324)
Name: NF9879_low_55
Description: NF9879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9879_low_55 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 146; Significance: 7e-77; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 146; E-Value: 7e-77
Query Start/End: Original strand, 16 - 161
Target Start/End: Complemental strand, 31979100 - 31978955
Alignment:
| Q |
16 |
ctcatttcacatgaaccatcaatcactttaatcataaaaacaaatgttgaacgtccatccatttgtttggttgattgattttgatgggatagacttaagt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31979100 |
ctcatttcacatgaaccatcaatcactttaatcataaaaacaaatgttgaacgtccatccatttgtttggttgattgattttgatgggatagacttaagt |
31979001 |
T |
 |
| Q |
116 |
tgagttaatcaatgaatattcacttgtctctcttctcaacctatag |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31979000 |
tgagttaatcaatgaatattcacttgtctctcttctcaacctatag |
31978955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 226 - 314
Target Start/End: Complemental strand, 31978902 - 31978814
Alignment:
| Q |
226 |
catatgatgtgattatgacaagatgaagcccacggtttcaaatcatcaagtggtttcctattcagaaagtgaatgtgatgagacctttg |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
31978902 |
catatgatgtgattatgacaagatgaagcccacggtttcaaatcatcaagtggtttcctactcagaaagtgaatgtgatgagacctttg |
31978814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University