View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9879_low_75 (Length: 270)
Name: NF9879_low_75
Description: NF9879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9879_low_75 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 255
Target Start/End: Complemental strand, 10983211 - 10982957
Alignment:
| Q |
1 |
ccagacttgatgagctggcagtttgccctaaacaatcctgattttccctcctaagccgtcattaattgcaaggattatctgccaaccacccacttcctct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
10983211 |
ccagacttgatgagctggcagtttgccctaatcaatcctgattttccctcctaattcgtcattaattgcaaggcttatctgccaaccacccacttcctct |
10983112 |
T |
 |
| Q |
101 |
tgggcgcatttattgtgacctttcatgtacatcattcaaccaatcaaatcctttgctttcccacttctccctcacagcgcaataaatgtacaatgaccaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
10983111 |
tgggcgcatttattgtgacctttcatgtacatcattcaaccaatcaaatcctttgctttcccacttctccctcacatcccaataaatgtacaatgaccaa |
10983012 |
T |
 |
| Q |
201 |
ttaacttactgctaaaaacgtgccccttttattggtaatcgggtgatggagcaga |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
10983011 |
ttaacttactgctaaaaacgtgccccttttattggtaaccgggtgatggagcaga |
10982957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 1 - 51
Target Start/End: Complemental strand, 31525560 - 31525509
Alignment:
| Q |
1 |
ccagacttgatgagctggcagt-ttgccctaaacaatcctgattttccctcc |
51 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || ||||| |||||||||| |
|
|
| T |
31525560 |
ccagacttgatgagctggcagtgttgccctaatcactcctgtttttccctcc |
31525509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 1 - 51
Target Start/End: Original strand, 33365942 - 33365993
Alignment:
| Q |
1 |
ccagacttgatgagctggcagt-ttgccctaaacaatcctgattttccctcc |
51 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || ||||| |||||||||| |
|
|
| T |
33365942 |
ccagacttgatgagctggcagtgttgccctaatcactcctgtttttccctcc |
33365993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 1 - 51
Target Start/End: Complemental strand, 49195516 - 49195465
Alignment:
| Q |
1 |
ccagacttgatgagctggcagt-ttgccctaaacaatcctgattttccctcc |
51 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || ||||| |||||||||| |
|
|
| T |
49195516 |
ccagacttgatgagctggcagtgttgccctaatcactcctgtttttccctcc |
49195465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University