View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9879_low_89 (Length: 251)
Name: NF9879_low_89
Description: NF9879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9879_low_89 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 161; Significance: 6e-86; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 20 - 238
Target Start/End: Complemental strand, 13309769 - 13309553
Alignment:
| Q |
20 |
gagtcggaatttctatacctatagttattgttgtaccgtgtagcagatgtagggaccgtttaatttagagaannnnnnnnncctctagatccaacggtcc |
119 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
13309769 |
gagtcggaatttctatacctatagttgttgttgtaccgtgtagcagatgtagggaccgtttaatttagagagaatttttttcctctagatccaacggtcc |
13309670 |
T |
 |
| Q |
120 |
ctacgaccacagcacgatacagaaggttggagtgtaaggtagttaagatgtttcagacacttcggagagcgagacttgggacgttcaagttcaaacccag |
219 |
Q |
| |
|
|||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
13309669 |
ctacgaccactgcacgatacagaaggttgtagtgtaaggtagttaagatgtttcagacacttcggagagc--gacttgggacgttcaagttcaaacccag |
13309572 |
T |
 |
| Q |
220 |
gagtgaacattgtttgtct |
238 |
Q |
| |
|
||||||||| ||||||||| |
|
|
| T |
13309571 |
gagtgaacaatgtttgtct |
13309553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University